jeudi 26 septembre 2013

La biologie et les sciences de l'éducation... un mur s'effrite ?

La biologie et les sciences de l'éducation... un mur s'effrite ?

Les lecteurs des Bio-Tremplins sont sans doute conscients que les frontières de la biologie bougent. Par exemple celles entre biologie neurosciences psychologie et philosophie ( Par exemple Bio-Tremplins du 17 septembre 2010 : Imagerie cérébrale : faut-il repenser l'humain émotionnel ?)

Une de ces frontières particulièrement pertinente pour les enseignants se situe entre les recherches en éducation et celles en neurosciences. Ainsi le fonctionnement du cerveau - un thème classique de la biologique enseignée - pose des questions sur la manière dont un cerveau apprend et sur la manière dont on doit aider les élèves apprendre - ce qui correspond à l'expérience et la pratique des enseignants mais était surtout traitées en sciences de l'éducation. Et on sait que ce que les savoirs issus de ces recherches-là - même quand ils apportent des solutions aux problèmes rencontrés par les enseignants - ne sont pas facilement intégrés dans l'enseignement. Le fait que ces mêmes questions soient formulées et traitées dans des termes et une communauté à laquelle les scientifiques s'identifient plus facilement et des revues qu'ils ont l'habitude de lire peut contribuer à impliquer les enseignants dans la réflexion sur ce qu'ils font depuis longtemps.
Par exemple un rapport de l'OCDE. (2007). Comprendre le cerveau : naissance d'une science de l'apprentissage.   Comment  Obtenir un article mentionné : Get-a-doi
D'autre part Science fait un Review sur le thème Meltzoff, A. N. (2009).Science | Intranet.pdf  Ou encore un rapport de l'académie des sciences aux USA Bransford, J. D.,  et al (2000). How people learn.  brain, mind, experience, and school: National Academy Press Washington, DC.

cerveau et apprendre

Fig 1: Les liens entre recherche sur le cerveau et celles sur apprentissage se multiplient [img] source FRC (fédération pour la recherche sur le cerveau)

Depuis un autre front la séparation Biologie - Sciences de l'éducation s'effrite : le rôle de l'évolution sur les mécanismes d'apprentissage dans le cerveau d'apprentissage. Bolhuis, J. J., & Wynne, C. D. L. (2009). Can evolution explain how minds work ? Nature, 458(7240), 832-833.| Intranet.pdf

Le succès énorme de la formation continue sur  Cerveau et apprentissage l'an passé montre bien l'intérêt des enseignants pour ces questions.
Une formation continue de cette année contribue à casser ce mur de Berlin en approchant depuis les neurosciences...  Il reste quelques jours pour s'inscrire !
Sciences expérimentales et de la nature interdisciplinaire

La biologie change en profondeur vers une biologie de l'information qui offre de nouvelles opportunités

D'autres formations permettent de se tenir au courant des changements de la discipline biologie qui a cette particularité que l'avancée de la discipline de référence modifie ce qui peut et doit être enseigné dans le secondaire. En particulier le changement vers une biologie de l'information qui transforme en profondeur la recherche et offre de nouvelles opportunités  d'expérimentation en classe développés avec Marie-Claude Blatter  La biologie a changé : Comment enrichir mes cours? 
la réflexion qui sous-tend cette approche est développée (Lombard, F. (2010) article ici .

Marie-Claude Blatter  poursuit cette approche avec d'autres experts dans une formation continue cette année sur la phylogénie des plantes. 
Biologie
Notons aussi  aussi une formation sur l'écophysiologie - qui est trop souvent passée sous silence dans nos classes. Comme si les plantes étaient statiques et se réduisaient à la photosynthèse et leur classification

Sources :

  • Bransford, J. D., Brown, A. L., & Cocking, R. R. (2000). How people learn.  brain, mind, experience, and school: National Academy Press Washington, DC.
  • Bolhuis, J. J., & Wynne, C. D. L. (2009). Can evolution explain how minds work? Nature, 458(7240), 832-833. | Intranet.pdf
  • Centre for Educational Research and Innovation. (2007). Comprendre le cerveau: naissance d'une science de l'apprentissage. Paris: OCDE. Consulté à l'adresse http://site.ebrary.com/lib/alltitles/docDetail.action?docID=10406469
  • Fischer, K. W. (2009). Mind, Brain, and Education: Building a Scientific Groundwork for Learning and Teaching1. Mind, Brain, and Education, 3(1), 3-16.
  • OCDE. (2007). Comprendre le cerveau : naissance d'une science de l'apprentissage
  • Lombard, F. (2010). New opportunities for authenticity in a world of changing biology. Proceedings of the 'Authenticity in Biology Education: Benefits and Challenges'. 13-19 july 2010, Braga Portugl
  • Meltzoff, A. N., Kuhl, P. K., Movellan, J., & Sejnowski, T. J. (2009). Foundations for a New Science of Learning. Science, 325(5938), 284-288. doi: 10.1126/science.1175626 | Intranet.pdf

La plateforme  Expériment@l vous offre l'accès à ces articles  Comment s'inscrire à Expériment@l

mardi 24 septembre 2013

Formation continue : La face cachée du sommeil ... mais sans tarder : délai lundi 30 septembre !

Une collègue me propose de partager avec vous sa satisfaction sur une formation continue sur le sommeil  qui offre encore des places ( s'inscrire d'ici le 30 soit lundi prochain !)
Dans le cadre de ce projet ils ont préparé une formation continue qui se déroulera le 29 octobre, des ateliers pédagogiques, une brochure sous forme de BD, pour les jeunes et la possibilité de participer à un festival du film (du DIP) sur le thème du sommeil.
Mais, en plus de ce volet pédagogique une équipe de recherche de l’UNIGE et des HUG investiguera la qualité du sommeil des ados genevois et l’impact des NTIC sur leur sommeil.
C'est donc aussi l'occasion de participer à une recherche et de rencontrer des chercheurs, de faire mieux connaitre les enjeux de la recherche auprès des élèves  …

Vous avez certainement reçu un 'flyer' bleu: LA FACE CACHEE DU SOMMEIL...

Je vous encourage très vivement à participer à la FC du 29 octobre, et plus si entente (projet de recherche avec les élèves)!
En effet, j'ai fait fonction de classes-pilotes l'année passée, et non seulement c’était extrêmement intéressant quant aux infos dispensées, mais en plus les élèves étaient réellement preneurs, impliqués et touchés par cette problématique!

Donc... allez-y, ... l'équipe du CMU et les médecins de l'unité de médecine du sommeil ont fait un très bon boulot!

Voici le lien pour la FC:
http://ge.ch/formation/sc1105DisplayAction.do?offre=CO&typevue=cours&trivue=code&idstage=CO-00621

Elle est ouverte à tous les ordres d'enseignement!
Tania Buhler

si vous n'arrivez pas à lire ce message correctement, cliquez ici pour l'ouvrir dans votre navigateur.
Participez à un projet pédagogique sur le sommeil des jeunes et faites avancer les connaissances scientifiques dans ce domaine!
A l’heure où l’utilisation quotidienne des nouvelles technologies de l'information et de la communication (NTIC) est en continuelle augmentation, se pose la question de l’impact de ces comportements sur notre santé. Dans ce contexte, l'Université de Genève et les Hôpitaux Universitaires de Genève proposent, pour l’année scolaire 2013-2014, un projet novateur sur le sommeil et la démarche scientifique
Cette initiative comprend un volet pédagogique qui vise, par le biais de différents outils - ateliers, formation continue, concours vidéo et brochure illustrée - à améliorer les connaissances scientifiques des jeunes sur le sommeil et à les sensibiliser à ses impacts multiples sur leur quotidien. En lien avec ce volet pédagogique, une équipe de recherche investiguera les habitudes de sommeil de vos élèves, tentera d'évaluer l’impact de l’usage des NTIC sur leur sommeil et l’influence du sommeil sur leurs performances et leur bien-être.
Inscrivez-vous dès les 16 septembre sur
neurocenter.unige.ch/sommeil

En partenariat avec le Service Écoles-Médias,
le Service de santé de la jeunesse et la Radio Télévision Suisse.
Avec le soutien de



Formation continue romande : des gènes aux protéines , Travaux pratiques

Alors que les plus assoiffés de savoir parmi vous ont déjà planifié leurs formations pour l'année, les moins empressés - ou les plus investis dans leurs cours avec les élèves - n'ont peut-être pas tout a fait décidé que suivre dans l'offre très large dont nous disposons. En plus des cours plus larges concernant la gestion de classe, la relation éducative, etc. les cours pour la biologie offerts à Genève  sont


Biologie
En plus on me signale une formation romande qui peut intéresser certains si je suis bien informé les frais du cours peuvent êtr remboursés- vérifier aurps de vos directions.

Voici donc une proposition de formation continue proposée par la Commission Romande de Biologie et Yves Gallay et ayant pour thème : Travaux pratiques : des gènes aux protéines

Celle ci aura lieu le vendredi 22 et le samedi 23 novembre 2013 au collège du Sud, rue de Dardens, 1630 Bulle
Public-cible : professeurs de biologie du secondaire II
Les inscriptions peuvent se faire jusqu'au 31 octobre 2013 auprès de Yves Galley, organisateur du cours et intervenant (galleyy@edufr.ch)

Dates : le vendredi 22 et le samedi 23 novembre 2013 Lieu : collège du Sud, rue de Dardens, 1630 Bulle Public-cible : professeurs de biologie du secondaire II
Prix : 150 CHF
Nombre de participants maximum : 24
Les inscriptions peuvent se faire jusqu'au 31 octobre 2013 auprès de Yves Galley, organisateur du cours et intervenant (galleyy@edufr.ch)
Canevas
Durant ce cours de formation continue, les participants effectueront 4TP ayant pour thème : des gènes aux protéines
Les facteurs influençant l'activité des enzymes
Les enzymes sont abordés au cours de base, aussi bien que dans les cours d'option spécifique et complémentaire. Comme ces molécules jouent un rôle central dans le métabolisme cellulaire et que leur dysfonctionnement peut générer des troubles physiologiques importants, il est intéressant de mettre en évidence le fait que ces molécules peuvent être sensibles aux conditions physico-chimiques de leur environnement. Le TP proposé met en évidence l'action inhibitrice de certains métaux ou de la variation de pH sur l'activité de l'amylase. La mesure de l'activité se fait par spectrophotométrie.
Exportation de la saccharase
Les enzymes sont produits à l'intérieur des cellules. Mais leur action peut se faire à l'extérieur de celles-ci. Certains enzymes sont donc exportés, c'est le cas de la saccharase chez la levure du boulanger. Cette exportation sera mise en évidence par 2 méthodes : la chromatographie et l'activité enzymatique du milieu extracellulaire.
Présence d'enzymes dans des produits courants
Les enzymes, grâce à leur activité de catalyseurs, sont intéressants pour l'industrie. Ils permettent donc des réactions à des conditions plus faciles à mettre en place. La lessive est un exemple de l'utilisation des enzymes, qui permettent de laver efficacement à des températures plus basses. La mise en évidence de ces enzymes dans la lessive utilise le fait que les lessives contiennent des protéases.
Génétique des pigments des yeux de la drosophiles
L'hypothèse de « 1gène-1 enzyme » avancée par Beadle et Tatum en 1941 (lauréats du prix Nobel de Médecine en 1958) était basée sur leur travail avec Neurospora crassa. Mais avant d'utiliser ce champignon, Beadle et Tatum ont utilisé la drosophile, en s'intéressant plus spécifiquement aux pigments de leurs yeux Certains mutants peuvent manquer de certains pigments ou présenter des quantités différentes de la souche sauvage. La production de ces pigments étant sous l'influence de gènes particuliers, cette méthode va nous permettre de mettre en évidence les gènes mutés à la manière de Beadle et Tatum
Ce cours sera aussi l'occasion de partager ses propres expériences avec des collègues d'autres cantons, échanges qui seront sans aucun doute fructueux.
Le programme détaillé sera envoyé aux personnes inscrites.
Présentation du cours

mercredi 18 septembre 2013

CRISPR - le couteau suisse génétique ?

La révolution CRISPR ?

Dans un News Focus de Science Pennisi, E. (2013) intranet.pdf fait un petit historique de la découverte d'un mécanisme de protection des bactéries contre les virus. Il en résulte une technique et un pan nouveau de recherche qui  se développe exceptionnellement rapidement et mérite l'attention des abonnés aux Bio-Tremplins.
C'est en cherchant à protéger les bactéries qui font le yoghourt (Streptococcus thermophilus p. ex.) dans l'industrie laitière danoise que des chercheurs ont réussi à booster les défenses bactériennes en présentant aux bactéries l'ADN des virus. Forts des techniques de séquençage et de bioinformatique actuelle, ils ont contribué à élucider ce mécanisme, parfois comparé à un système immunitaire bactérien (cf fig1). CRISPR  est constitué d'un ARN guide constant, attaché à une séquence spécifique de l'ADN à cibler, et d'une protéine Cas9 qui accueille cet ARN et guide le positionnement de cet ARN sur l'ADN-cible et découpe les deux brins d'ADN à la position correspondante.  Cf par exemple Brouns, S. J. J., et al. (2008). intranet.pdf Comment  Obtenir un article mentionné : Get-a-doi

Figure
Fig 1: Quand des virus (en vert) attaquent une bactérie, elle déploie des défenses contre l'ADN viral que les biologistes ont appris a utiliser pour le génie génétique  [img] source Pennisi, E. (2013): EYE OF SCIENCE/SCIENCE 
En quelques mois des chercheurs du monde entier ont pu exploiter sa spécificité et sa simplicité pour intervenir dans les génomes directement ou en modifiant la protéine.
UniProt - la célèbre base de protéines basée à Genève a publié 2 headlines sur le sujet :

CRISPR : Un ARN en deux parties et une protéine 

CRISPR  est constitué d'un ARN guide, en partie palindrome (définition ici) constant, attaché à une séquence ARNcr spécifique de l'ADN à cibler, et d'une protéine Cas9 (cf. fig 2) qui accueille cet ARN et guide le positionnement sur l'ADN-Cible et découpe les deux brins à la position correspondant à la fin de la séquence guide.

Figure2
Fig 2 : Le mécanisme d'action de CRISPR est simple et modulaire . Cliquer pour agrandir. Il est développé plus bas  [img] source : Pennisi (2013)

Chez les bactéries ce sytème permet en intégrant de courts fragments d'ADN étranger dans le système CRISPR  d'armer la bactérie contre de nouvelles attaques de ce même agent pathogène (Virus, mais aussi plasmides, éléments conjuguants, ou transposables) . C'est ce qui a sauvé les cultures de bactéries dans l'industrie laitière Danoise…
"Resistance is acquired by incorporating short stretches of invading DNA sequences in genomic CRISPR loci " Brouns, S. J. J., et al. (2008)

Un système simple et polyvalent

La simplicité de ce système permet de fabriquer des ARN ciblant à volonté des séquences très spécifiques chez divers organismes, de les accoler au palindrome, et pour autant que Cas9 soit présent l'ADN sera coupé à l'endroit spécifique. Ce système n'est pas sans rappeler l'ARN interférant des Eukaryotes (cf Bio-Tremplins un commando de 9 prend le contrôle de 273 )
La polyvalence du système est exprimée dans l'illustration de Science (fig. 2) qui figure chacun des sites actifs de Cas9 comme un couteau suisse
 
  • Cas9 chez UniProt G3ECR1 CRISPR-associated endonuclease Cas9 Streptococcus thermophilus (1,409 bases)
Selon Pennisi, la simplicité et la modularité du système permet de réaliser des interventions ciblées qui permettront des recherches bien plus vite et plus précisément. En effet, en modifiant la protéine de chercheurs ont supprimé les sites actifs mais y ont joint des protéines à l'activité connue, afin d'associer la spécificité de CRISPR à cette activité.

Par exemple en associant un répresseur à Cas9, ils ont pu bloquer un gène spécifié par la séquence d'ARN associée à Cas9 (cf. Fig 3.gauche) . En associant un promoteur,  ils ont pu activer un gène spécifique (cf. Fig 3.droite) .

Fig 3 : Les chercheurs on pu exploiter le mécanisme d'action de CRISPR en modifiant la protéine Cas9 pour spécifiquement activer ou réprimer l'expression d'un gène. [img] source : K. SUTLIFF/SCIENCE in Pennisi (2013)


Modulaire et spécifique, ce système permet de nombreuses applications en génie génétique

En modifiant la protéine Cas9 d'autres chercheurs ont pu effectuer à l'endroit spécifié par l'ARN guide d'autres interventions comme bloquer un gène – en associant un répresseur à Cas9, activer un gène – en associant un promoteur, ou ouvrir l'ADN ( "nick") en supprimant un des sites actifs – pour insérer un ADN thérapeutique à un endroit précis.

Figure
Fig 4: En 8 mois on a pu montrer l'efficacité du système CRISPR chez divers organismes (Caenorhabditis elegans, Danio rero, Drosophila)   [img] source Pennisi (2013) CREDITS (TOP TO BOTTOM): FRIEDLAND ET AL., NATURE METHODS 10 (JUNE 2013); ANDREW GONZALES/JOANNA YEH; SCOTT GRATZ/UNIVERSITY OF WISCONSIN, MADISON

Ouais ... ces séquences on peut les voir m'sieur ?

Qu'un élève ait encore assez de curiosité pour poser cette question est rare, mais le principe d'accès libre à l'information imposé par les revues scientifiques entre autres implique qu'on peut accéder aux séquences de toute recherche publiée (Cf BIST) et adopter une démarche expérimentale et satisfaire le scepticisme de cet élève : vérifier sur la base de données cette affirmation...
Marie-Claude Blatter du SIB nous rappelle que " Le cr RNA est composé d'une séquence 'spacer' spécifique et d'une séquence palindrome." Par exemple dans Brouns, S. J. J. et al  (2008) on trouve :



D'autre part, elle nous indique Palindrome search un outil qui permet de détecter les séquences palindromiques: http://bioinfo.cs.technion.ac.il/projects/Engel-Freund/new.html (! il faut mettre la séquence en format fasta c'est à dire précéder la séquence par une ligne qui commence avec un > suivi d'une description - en fait on peut mettre n'importe quoi après le >)
Si on insère dans l'outil à détecter les palindromes la séquence trouvée ci-dessus - dûment labellisée pour FASTA :
>E coli CRISPR
gagttccccgcgccagcggggataaaccgctttcgcagacgcgcggcgatacgctcacgca
 on découvre bien un palindrome :

5   TCCCCGCG   12
    |||||||
22  AGGGGCGA   15


Autre exemple plus récent

Dans un papier récent Chen, et al. (2013)Comment  Obtenir un article mentionné : Get-a-doi  ont modifié C. elegans , et on trouve dans les supplementary data ici la séquence guide qui permet la fixation de l'ARN sur la protéine Cas9 dûment labellisée en format fasta :  
>Exemple pris chez Chen pour modifier C. elegans
GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCT

Si on insère dans  Palindrome search cette séquence  on trouve

61   GGCACCGA   68
      |||||||
77   TCGTGGCT   70


D'autres exemples

M.-C. Blatter nous indique comment trouver quelques cr RNA spacer dans GenBank: (la sequence spacer qui reconnaît la cible) : http://www.ncbi.nlm.nih.gov/nuccore/?term=%22crispr+rna%22

Trop compliqué pour les élèves ?

Peut-être…  il est surtout nouveau pour les enseignants et n'est pas encore entré dans les pratiques enseignantes ( transposition didactique à faire ?)

D'une autre coté le système CRISPR n'est pas bien complexe et par sa nouveauté il peut renouveler les exemples, les exercices voire les évaluations…

Des articles vulgarisés en français  ? 

Sources :

  • Chen, Changchun, Lorenz A. Fenk, Mario de Bono. (2013) Efficient genome editing in Caenorhabditis elegans by CRISPR-targeted homologous recombination Nucl. Acids Res. first published online September 5, 2013 doi:10.1093/nar/gkt805
  • Brouns, S. J. J., Jore, M. M., Lundgren, M., Westra, E. R., Slijkhuis, R. J. H., Snijders, A. P. L., … van der Oost, J. (2008). Small CRISPR RNAs Guide Antiviral Defense in Prokaryotes. Science, 321(5891), 960‑964. doi:10.1126/science.1159689 | intranet.pdf
  • Pennisi, E. (2013). The CRISPR Craze. Science, 341(6148), 833‑836. doi:10.1126/science.341.6148.833 | intranet.pdf

La plateforme  Expériment@l vous offre l'accès à ces articles  Comment s'inscrire à Expériment@l

lundi 9 septembre 2013

Des neurones spéciaux pour les câlins ?

Les phanères ne servent pas seulement  à la thermorégulation… 

Une étude récente met en évidence des neurones particuliers sensibles aux caresses. Ces neurones  réagissent spécifiquement à des stimulations "caressantes" par un pinceau alors que d'autres ne répondent qu'à des stimulations pénibles comme le pincement ou les piqûres.
Des chercheurs ont identifié un récepteur moléculaire spécifique qui permet d'identifier leur position et les activer expérimentalement. Ces neurones sont présents chez les souris, mais on en trouve des similaires chez l'humain là où la peau porte des poils, mais pas sur la paume des mains par exemple.
caresser est une activité sociale          importante chez les primates
Fig 1 : Nature titre sur cette découverte [img] source  Roberto Westbrook/Blend Images/Corbis

Les caresses : un besoin psychologique ?

Nous avons probablement tous observé combien les chats, les chiens apprécient les caresses, et je vous souhaite d'avoir pu ressentir que les humains aussi.
Leur besoin critique est mentionné par les auteurs en référence aux expériences de Harlow, Harry F. (1959) “Love in Infant Monkeys,”.
harlow
Fig 2: Harlow avait déjà mis en évidence le besoin de caresses chez le nouveau-né chez d'autres primates que nous  [img] source  Harlow

De nombreuses recherches portent sur la douleur, parce qu'elle est sans doute plus importante médicalement mais aussi parce qu'elle est plus facile à étudier chez les souris (évitement, retrait etc). Il y a tout de même des recherches sur les bases neurologiques des caresses et la présence de neurones spécifiques pour ce type de stimulus est connu depuis Olausson, H. (2002). Ils ont montré  que des voies nerveuses spécifiques sont en jeu, mais la nature des récepteurs n'était pas établie.

caresse
Fig 3: Chez l'humain on avait déjà démontré que les caresses suivent des voies nerveuses indépendantes [img] source  Pearson, Helen (2002)

Les auteurs - sur la base de l'étude par IRMf d'une patiente dépourvue des neurones myélinisés et d'une grande part du toucher mais qui percevait les touchers agréables - suggéraient alors que cette voie pourrait sous-tendre les réponses émotionnelles hormonales et affectives des caresses. 
"These findings identify CT as a system for limbic touch that may underlie emotional, hormonal and affiliative responses to caress-like, skin-to-skin contact between individuals."Olausson, H. (2002) Comment  Obtenir un article mentionné : Get-a-doi
Mais les récepteurs impliqués n'étaient pas connus, et la recherche de (Vrontou, S., et al. 2013) montre que nous avons une double innervation tactile de la peau pileuse; l'une d'entre elle,  qui est lente (C Tactile) met en jeu des neurones non myélinisés qui répondent à des stimulations faibles et activent les aires de l'insula du cerveau mais pas les aires somatosensorielles.


Fig 4 :Les aires somatosensorielles [img] source Figure 9.8 dans  Purves, Dale. et al.,(2006).

L'étude est rapportée dans une News de Nature ( Mice have 'massage neurons') par Thea Cunningham avec une très amusante vidéo qui décrit l'expérience.
Vrontou et al.  mettent en évidence chez la souris un récepteur moléculaire particulier aux stimulations douces comme les caresses : MRGPRB4. C'est une classique G-Coupled Protein transmembranaire – comme de nombreux récepteurs.  Comment  Obtenir un article mentionné : Get-a-doi
  • La protéine, sa séquence chez uniProt Q91ZC0
Fort de cette séquence ils ont pu l'activer par des voies pharmacologiques (avec des molécules qui les activent) pour en vérifier la spécificité et la répartition.

Fig 5: Les différentes simulations testées  [img] source  Vrontou, S.,et al (2013)

Les chercheurs ont réussi à monter un dispositif ingénieux qui stimule la souris de manière "caressante" ou plus ferme (pincement ou poking (~piqûre légère), cf. fig. 5), pour montrer que MRGPRB4 n'est pas activé lors de stimuli désagréables, mais seulement lors de caresses avec un pinceau. Ils ont utilisé une technique où les neurones fluorescent quand ils sont actifs. Leur réaction à des stimuli donc être suivie visuellement. Ils ont ainsi montré que les neurones CT (C Taciles) munis de MRGPRB4 ont une sensibilité distincte d'autres neurones CT anatomiquement semblables munis de récepteurs ( MRGPRD) sensibles aux stimulations désagréables.
  • Séquence et liens pour MRGPRD Chez l'humain Q8TDS7
Ils ont exploré les dimensions affectives par des expériences comportementales : en activant ces neurones dans une loge de leur espace (cf fig. 6) ils ont pu observer que les souris y retournaient préférentiellement, suggérant que ces neurones ont un effet de renforcement ou anxiolytique et pas seulement un effet local dans la peau.

Fig 6: Les souris ont été conditionnées dans différentes loges de leur cage pour étudier l'effet comportemental (calmant?) de ces récepteurs [img] source  Vrontou, S.,et al (2013)

Les potentiels?

L'article termine classiquement par l'évocation des potentiels de cette découverte... et s'ils reconnaissent que les applications thérapeutiques ne sont pas pour demain, l'un des auteurs envisage une crème stimulant ces récepteurs à appliquer à votre animal familier pour le calmer en votre absence – comme si vous le caressiez…
Imagine smearing something on their skin that makes them feel like they're being stroked and petted even when you're away at work!  It might make your pets feel better and make you feel less guilty for leaving them home alone,” Anderson, David, responsable de l'étude.
J'entends le petit malin au fond de la classe qui glousse son incrédulité. Et l'imagination fertile des adolescents imaginer d'autres applications entre humains...

Et en français ?

Comme toujours les savoirs percolent depuis la publication d’origine vers la littérature grand public. En se vulgarisant ils perdent les circonstances des mesures, le cadre théorique, les limites et les incertitudes, se focalisent sur une conclusion à sensation ... mais touchent un public plus large.

  • Furura-sciences est assez peu vulgarisé  ici 
  • Pour la Science propose dans les actualités un court texte par Sébastien Bohler  ici
  • La Recherche propose aussi une brève ici
On voit que la crème qui remplacerait les massages frappe l'imagination mais devient une pilule.

Bio-Tremplins avait par ailleurs publié un article sur les effets du massage ici L'acide lactique, mythes et récentes découvertes. 

De nouvelles questions

Comme souvent une recherche répond à une question et en soulève plusieurs nouvelles qui permettront d'aller plus loin – c'est une des  caractéristiques de l'investigation qui conduit à l'affinage conceptuel.

- Ces récepteurs sont-ils effectivement présents chez l'humain et ont-ils le même rôle chez nous ? Et chez la plupart des mammifères ?
- Si oui, le rôle crucial des caresses - au moins dans la petite enfance – serait confirmé par le maintien à travers l'évolution de ces neurones : sans sélection ils seraient vraisemblablement disparus.
- La présence de ces récepteurs seulement sur la peau munie de poils serait-elle la raison du maintien de rares poils sur une bonne part du corps chez l'humain ?
- La même question se pose pour l'éléphant qui a des poils fort peu visibles et dont l'utilité n'est pas évidente il me semble.

Fig 7 : Les éléphants semblent apprécier les caresses : est-ce par ces mêmes récepteurs et cela explique-t-il leurs poils  [img] source  Cunningam, T. (2013)

Une question que des élèves pourraient soulever est pourquoi on ne peut pas se chatouiller soi-même. Une étude en IRMf suggère que les influx venant de la périphérie sont bloqués avant d’arriver à l'aire somatosensorielle. Cf. Lawrence, E. (1998). Why you can’t tickle yourself. Nature News. doi:10.1038/news981022-7  Comment  Obtenir un article mentionné : Get-a-doi

La plateforme  Expériment@l vous offre l'accès à ces articles  Comment s’inscrire à Expériment@l

Sources :